News and Announcements » |
This document describes how to process Illumina sequencing data with QIIME. As the Illumina platform is just beginning to be used for community sequencing, the Illumina support in QIIME is still in development status. If you run into issues because your Illumina output is different from what we assume here, we recommend getting in touch via qiime.help@colorado.edu. Full support for analyzing community sequencing data generated on the Illumina platform is one of our goals, so we’re willing to help out.
QIIME can be used to parse single-end or paired-end read data from the Illumina platform. The downstream support for analysis of paired-end read data is currently more limited. The parsed output is in standard fasta format, so all scripts (such as align_seqs.py and assign_taxonomy.py) can read it. However because there may be a ‘big gap’ between the 5’ and 3’ reads if the primers are distant in the sequence, or conversely because the reads may overlap if the primers are close, your mileage with the downstream tools may vary.
This example illustrates how to used split_libraries_illumina.py to parse your Illumina output into a format that can be used by QIIME.
The input to split_libraries_illumina.py is one or more sequence files, and a standard QIIME mapping file. For example, 10 lines extracted from a s_1_1_sequence.txt file (where the first 1 refers to the lane, and the second 1 refers to the read, indicating the 5’ read in this case) are:
HWI-6X_9267:1:1:12:410#ACAGCTA/1:TACGTAGGGTGCGAGCGTTAATCGGAATTACTGGGCGTAAAGCGTGCGCAGGCGGCATTTTAAGCCAGACGTGAAATCCCCGGGCTTAACCTGGGAACTG:abbb`aaa`^aa```ba`aaaabaaaabaaaa^[Y]^__a`abb`aaaa]Y\\_a[Y_a`a```a__]aaXT\`^\_]`a^^WSZ\JNY]^a`ORO^^`Y
HWI-6X_9267:1:1:12:1762#ACATGAT/1:GACGGAGGATGCAAGTGTTATCCGGAATCACTGGGCGTAAAGCGTCTGTAGGTTGTTTGATAAGTCAACTGTTAAATCTTGAAGCTCAACTTCAAAATCG:aaaaaaaaabaaaaa_aaaaaa`aaaaaaaa`aa``a]aa```a^a^`\```\a`^aaa_\__]]_a_``^``a^^a^b[`SJN]Y_ZZ]^W___`_^U[
HWI-6X_9267:1:1:12:1872#ACAGTTG/1:TACGGAGGGGGTTAGCGTTGTTCCGAATTACTGGGCGTAAAGCGCGCGTAGGCGGATTAGAAAGTTGGGGGGGAAATCCCGGGGCTCAACCCCGGACGTG:aaaaa_aaaa`[a_a`aaaa]a[MY``a\a`aaaaa_\]_\__[_]W]^[[U]aXRZ\W[J\KVTX]\YZZDVY]SUBBBBBBBBBBBBBBBBBBBBBBB
You’ll notice that each line contains seven : delimited fields. These are:
- Machine name
- Channel/lane number
- Tile number
- X position
- Y position
- nucleotide sequence
- quality score
In this case, the Y position field additionally contains the reverse compliment of the barcode sequence as the first B bases following the # sign, where B refers to the barcode length as determined from the mapping file. If your data looks different from this, get in touch with qiime.help@colorado.edu, and we can try to work on custom solutions until standards are developed in this area.
One important thing to note is that our sequencing primers were developed to avoid sequencing the PCR primers. So unlike standard 454 data, there are no barcode, linker, or primer sequences that need to be extracted from these sequences. As a consequence, the LinkerPrimerSequence in the mapping file is not important. In the following example, we’ve simply included an identifier for the LinkerPrimerSequence. An example mapping file to match this data might look like:
#SampleID BarcodeSequence LinkerPrimerSequence SampleType Description
Sample1 AGCTGT ILBC_17 Freshwater creek_3-4_cm_depth
S2 AACTGT ILBC_19 Ocean ocean_2-3_cm_depth
S3 TCATGT ILBC_21 Ocean ocean_3-4_cm_depth
sample4 GCTGGT ILBC_26 Feces fecal_subject_5
To process a single lane of 5’ read Illumina data, you would run the command:
split_libraries_illumina.py -5 s_1_1_sequence.txt -o 5prime/ -m illumina_mapping.txt
Similarly, to process multiple lanes of 5’ reads of Illumina data, you would run the command:
split_libraries_illumina.py -5 s_1_1_sequence.txt,s_2_1_sequence.txt -o 5prime/ -m illumina_mapping.txt
Note that the sequence filepaths are comma-separated. There can be no spaces between the filepaths and the comma(s). This would result in four output files in 5prime/:
- s_1_5prime_seqs.fasta: lane 1 sequences which have passed quality filtering
- s_1_5prime_qual.txt: lane 1 quality scores for sequences which have passed quality filtering
- s_2_5prime_seqs.fasta: lane 2 sequences which have passed quality filtering
- s_2_5prime_qual.txt: lane 2 quality scores for sequences which have passed quality filtering
If you wish to combine the data from different lanes for downstream analysis, you can do this using cat. For example:
cat s_1_5prime_seqs.fasta >> s_5prime_seqs.fasta
cat s_2_5prime_seqs.fasta >> s_5prime_seqs.fasta
Parsing 3’ read data is handled in the same way as parsing 5’ read data, except that the -3 parameter is passed in place of the -5 parameter. For example, to process multiple lanes of 3’ Illumina read data, you would run the command:
split_libraries_illumina.py -3 s_1_2_sequence.txt,s_2_2_sequence.txt -o 3prime/ -m illumina_mapping.txt
It is very important that you get the orientation correct, as the sequences are adjusted differently according to whether they are passed as -5 or -3.
To process a single lane of paired-end read Illumina data, you would run the command:
split_libraries_illumina.py -5 s_1_1_sequence.txt -3 s_1_2_sequence.txt -o paired_end/ -m illumina_mapping.txt
To process multiple lanes of paired-end read Illumina data, you would run the command:
split_libraries_illumina.py -5 s_1_1_sequence.txt,s_2_1_sequence.txt -3 s_1_2_sequence.txt,s_2_2_sequence.txt -o paired_end/ -m illumina_mapping.txt
Note that you must correctly match the order of the sequence file paths passed via -5 and -3. In this case, the output sequence files will contain the 5’ ends of the reads concatenated with the 3’ ends of the reads. The orientations of the reads are adjusted so the full read makes sense. It is important to note however that aside from adjusting the read orientation, nothing is done to modify the read. So, for example, if your reads overlap there will be a repeat at the junction of the reads corresponding to the overlap.
The methods currently included in QIIME for quality filtering Illumina data are presented in a publication that has been provisionally accepted. A link to that article will be provided here upon full acceptance. Briefly, a sequence is discarded if any of the following conditions are met:
- The barcode contains one or more N bases, corresponding to ambiguous base calls.
- The barcode is not an exact match to a barcode in the mapping file (to disable this, pass -u, which will cause the resulting sequences to be store with sample ID Unassigned.)
- The sequence contains one or more N bases, corresponding to ambiguous base calls.
- The high-quality region of the sequence is less than 75 bases long (adjustable with the -p parameter), where high-quality regions is defined a stretch of bases containing no more than 1 (adjustable with the -r parameter) quality score less than 1e-5 (adjustable with the -q parameter). In other words, with the default parameter settings, the read is truncated at the base preceding the first low quality stretch, and the truncated sequence must be greater than or equal to 75 bases long to be retained.
Once you have processed your Illumina data with split_libraries_illumina.py, you can use the resulting files in all downstream QIIME scripts, including the workflow scripts. Currently the quality files (e.g., s_2_5prime_qual.txt) are not used anywhere in QIIME, but are provided to support more complex quality filtering. We are very interested in collaborating on developing better ways to quality filter Illumina data, so please feel free to get in touch if you have interest in this problem.