unweight_fasta.py – Transform fasta files with abundance weighting into unweighted

Description:

E.g. makes 3 fasta records from a weighted input fasta file containing the following record: >sample1_12_3 bc_val=20 AATGCTTGTCACATCGATGC

Usage: unweight_fasta.py [options]

Input Arguments:

Note

[REQUIRED]

-i, --input_fasta

The input fasta file

-o, --output_file

The output fasta filepath

-l, --label

Sequence label used for all records. fasta label lines will look like: >label_423

Output:

a .fasta file

make 3 fasta records from the following >sample1_12_3 bc_val=20 AATGCTTGTCACATCGATGC resulting in >goodsample_0 AATGCTTGTCACATCGATGC >goodsample_1 AATGCTTGTCACATCGATGC >goodsample_2 AATGCTTGTCACATCGATGC

unweight_fasta.py -i input.fna -o output.fna -l goodsample